pim1

Ensembl ID:
ENSDARG00000059120
ZFIN ID:
ZDB-GENE-061013-139
Description:
proto-oncogene serine/threonine-protein kinase pim-1 [Source:RefSeq peptide;Acc:NP_001070859]
Human Orthologue:
PIM1
Human Description:
pim-1 oncogene [Source:HGNC Symbol;Acc:8986]
Mouse Orthologue:
Pim1
Mouse Description:
proviral integration site 1 Gene [Source:MGI Symbol;Acc:MGI:97584]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41131 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082124 Nonsense 230 320 5 6
Genomic Location (Zv9):
Chromosome 8 (position 10912522)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 10269456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTACCACGGTCGATCCGCCACTGTTTGGTCTCTCGGCATTCTGCTGTA[C/A]GATATGGTCTGCGGGGACATCCCCTTTGAGCAGGACGAAGAGATCGTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link