LOC571772

Ensembl ID:
ENSDARG00000059116
Human Orthologue:
HEATR5B
Human Description:
HEAT repeat containing 5B [Source:HGNC Symbol;Acc:29273]
Mouse Orthologue:
Heatr5b
Mouse Description:
HEAT repeat containing 5B Gene [Source:MGI Symbol;Acc:MGI:2444098]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15239 Nonsense Available for shipment Available now
sa12245 Nonsense Available for shipment Available now
sa8993 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15239
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082127 Nonsense 202 1606 5 30
Genomic Location:
Chromosome 13 (position 347044)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTTGTGTGTGTGTGTGTGTGTNNNNNNNNNNTTYCGCAGTGTTTGT[T/A]GGARCTGCAGAACGAGGCTGTGTTCATCTGGACCACTGAGCTGGAGAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082127 Nonsense 386 1606 7 30
Genomic Location:
Chromosome 13 (position 345114)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAGCTCAGATCGCAGCCGCAAAGGAGATCTGCCTGGCCATCAGCAAA[C/T]AGATGAGAGCCGTGGGTAAGAYGRACTACATTACCCACAATCCCTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082127 Nonsense 810 1606 16 30
Genomic Location:
Chromosome 13 (position 339240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTTCTGTGTGCTGTGTCCTCCAGGTTGCAGATGCTGGATCACTTCGCT[G/T]AATGYATTAAGCAGGCTAAAGGCGTGCGGCAGCAGGCGGTGCAGCTCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1uwfc0ak