nktr

Ensembl ID:
ENSDARG00000059097
ZFIN ID:
ZDB-GENE-030131-1725
Description:
Nktr protein [Source:UniProtKB/TrEMBL;Acc:Q1JQ26]
Human Orthologue:
NKTR
Human Description:
natural killer-tumor recognition sequence [Source:HGNC Symbol;Acc:7833]
Mouse Orthologue:
Nktr
Mouse Description:
natural killer tumor recognition sequence Gene [Source:MGI Symbol;Acc:MGI:97346]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37874 Nonsense Mutation detected in F1 DNA During 2017
sa24485 Essential Splice Site Available for shipment Available now
sa37873 Nonsense Available for shipment Available now
sa37872 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082112 Nonsense 10 428 2 13
ENSDART00000123682 Nonsense 10 1396 1 16
ENSDART00000127923 Nonsense 10 1396 2 17
ENSDART00000127988 Nonsense 10 105 2 14
Genomic Location (Zv9):
Chromosome 24 (position 21265196)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20512325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGCCCACTCTGTGGAAAAAATGGGGGTGAAAGATCGCCCTCAGTGCTA[T/A]TTTGACGTGGAAATCAACAGAGAACCAGGTAAGATTTGACATTCATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082112 Essential Splice Site 95 428 5 13
ENSDART00000123682 Essential Splice Site 95 1396 4 16
ENSDART00000127923 Essential Splice Site 95 1396 5 17
ENSDART00000127988 Essential Splice Site 95 105 5 14
Genomic Location (Zv9):
Chromosome 24 (position 21260646)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20507775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAGGCAATGGAAGAGGGGGAGAATCTATATTTGGTGGTTTCTTTGAAG[G/A]TAAGCCATCTTCAGATCGGGTTTGGTTTGAATCAAGCACTCTGTAACCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082112   None 428 None 13
ENSDART00000123682 Nonsense 513 1396 12 16
ENSDART00000127923 Nonsense 513 1396 13 17
ENSDART00000127988   None 105 None 14
Genomic Location (Zv9):
Chromosome 24 (position 21255658)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20502787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTCTTCTAGAGATTCACGGTCTTATTCGAGATCTAGGAGCAGATCATA[T/A]TCTAGAAGTGACTCAAGGTCAGAGAGGCGGGCTCGATCATCCAAGAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37872
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082112   None 428 None 13
ENSDART00000123682 Nonsense 630 1396 12 16
ENSDART00000127923 Nonsense 630 1396 13 17
ENSDART00000127988   None 105 None 14
Genomic Location (Zv9):
Chromosome 24 (position 21255308)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20502437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGAGTGTCTCTGCATTGCCTATGAGTGACAGTCCACCACCTTCTCGAT[G/A]GAAACCAGGCCTGAAACCCTGGAAACCTTCTTATGTCCGTATCCCAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link