si:ch211-173b16.3

Ensembl ID:
ENSDARG00000059093
ZFIN ID:
ZDB-GENE-081104-19
Description:
Novel protein similar to vertebrate neuronal ankyrin family [Source:UniProtKB/TrEMBL;Acc:B8JK14]
Mouse Orthologue:
Ank1
Mouse Description:
ankyrin 1, erythroid Gene [Source:MGI Symbol;Acc:MGI:88024]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20591 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38529 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20590 Nonsense Available for shipment Available now
sa10842 Essential Splice Site Available for shipment Available now
sa10265 Nonsense Available for shipment Available now
sa26632 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40606 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090092 Essential Splice Site 363 1929 9 49
ENSDART00000137443   None 1050 None 26
Genomic Location (Zv9):
Chromosome 5 (position 71913197)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68237715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCCAAGGTGCTCCTGGATAAAGGAGCCAAACCAAACACCCGCGCTCTGG[T/G]CAGTGCACTTCCACAAAGAAGACTCCACACAATTAATGCATGTGATTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090092 Essential Splice Site 527 1929 14 49
ENSDART00000137443 Essential Splice Site 81 1050 2 26
Genomic Location (Zv9):
Chromosome 5 (position 71906863)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68231481
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCCAGCATCCTCCTGGACATGAACGCCCAGCTCACCAAAATGACCAAG[G/A]TACTGTTCATATGCTTGTAATCAATAATTTAACATATTATGATAATGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090092 Nonsense 780 1929 21 49
ENSDART00000137443 Nonsense 334 1050 9 26
Genomic Location (Zv9):
Chromosome 5 (position 71899361)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68223979
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTGCCATCGCCAAGCGGCTTGGATACATTTCAGTCATCGATGTGCTC[A/T]AACTGGTCACTGAAGAGACGGTCACTATGGTAAGAAAAATTGACATTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10842
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090092 Essential Splice Site 813 1929 22 49
ENSDART00000137443 Essential Splice Site 367 1050 10 26
Genomic Location (Zv9):
Chromosome 5 (position 71898489)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68223107
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTTTYCCTGAAACCGTTGATGAGATCCTGGAWGTGTCTGAAGATGAAG[G/A]TAAAAACAACTCTNNATTCACCATCACAATCTGTTTTTRMGTTATTAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090092 Nonsense 1026 1929 28 49
ENSDART00000137443 Nonsense 573 1050 16 26
Genomic Location (Zv9):
Chromosome 5 (position 71885762)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68210380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGCGGCTCTCGGTCGGGGAGATCGGGAACTCGTGGTCTTGAGGAGT[G/T]AGAACGGATCKGTCTGGAAGGARCATCGTAACCGATAYGGAGATGAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090092 Essential Splice Site 1344 1929 34 49
ENSDART00000137443 Essential Splice Site 891 1050 22 26
Genomic Location (Zv9):
Chromosome 5 (position 71867387)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68192005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATACCTGTATCATAATCACTCGTTTGTGCTTAATTTATCTCTATCTC[A/C]GGTGAGGGACAGCAGTAAAGACCCCTCTGGGTTTTTGTCTTTCTTGCGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090092 Nonsense 1862 1929 48 49
ENSDART00000137443   None 1050 None 26

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 71811967)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68136585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCATCTGTACACGTGGCTGATGTAGATTGTGAGGAAAGTGGTCCGG[A/T]GAGGAAAAGGGGAGGAAGGGGGTCAGGAGCTGATCATTGAAGGTCTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link