PPP2R5C (2 of 2)

Ensembl ID:
ENSDARG00000059083
Description:
protein phosphatase 2, regulatory subunit B', gamma [Source:HGNC Symbol;Acc:9311]
Human Orthologue:
PPP2R5C
Human Description:
protein phosphatase 2, regulatory subunit B', gamma [Source:HGNC Symbol;Acc:9311]
Mouse Orthologue:
Ppp2r5c
Mouse Description:
protein phosphatase 2, regulatory subunit B (B56), gamma isoform Gene [Source:MGI Symbol;Acc:MGI:134

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1622 Essential Splice Site Available for shipment Available now
sa7240 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa1622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082101 Essential Splice Site 230 385 7 12
Genomic Location (Zv9):
Chromosome 17 (position 273715)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1628105
KASP Assay ID:
554-1563.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCGAGCATCACAACGGAATAGCTGAACTCCTGGAGGTGCTGGGAAGG[T/C]AAAACACRAGCTTGTGACGTCTGTCCCTGTGCATGCTGGGAAATCCTCTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa7240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082101 Essential Splice Site 340 385 10 12
Genomic Location (Zv9):
Chromosome 17 (position 276571)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1630961
KASP Assay ID:
554-4532.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AKGGAGCCGCTCYTCAGACAGCTGGCCAAGTGTGTGTCCAGCCCGCACTT[C/T]CAGGTCANNGTGTGTGTGTGTGTGTGCSTGTGTCTGTGTGTTCATGTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Autism: A genome-wide scan for common alleles affecting risk for autism. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link