nip7

Ensembl ID:
ENSDARG00000059075
ZFIN ID:
ZDB-GENE-050522-256
Description:
60S ribosome subunit biogenesis protein NIP7 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q503P2]
Human Orthologue:
NIP7
Human Description:
nuclear import 7 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:24328]
Mouse Orthologue:
Nip7
Mouse Description:
nuclear import 7 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913414]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32182 Missense Available for shipment Available now

Mutation Details

Allele Name:
sa32182
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082087 Missense 48 180 3 5
Genomic Location (Zv9):
Chromosome 18 (position 4482295)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5231966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGCAAATGTGAATAAGTAATCTGTAATTTATTTGTTTTCCATTTTAG[T/A]GAAAAAATCCTGAAGTTGGCAACAAATGTCTCCAGAGATAAACTGGTATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link