gsc

Ensembl ID:
ENSDARG00000059073
ZFIN ID:
ZDB-GENE-980528-2060
Description:
Homeobox protein goosecoid [Source:UniProtKB/Swiss-Prot;Acc:P53544]
Human Orthologue:
GSC
Human Description:
goosecoid homeobox [Source:HGNC Symbol;Acc:4612]
Mouse Orthologue:
Gsc
Mouse Description:
goosecoid homeobox Gene [Source:MGI Symbol;Acc:MGI:95841]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32143 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082085 Nonsense 136 240 2 3
ENSDART00000138315 Nonsense 16 120 1 2
Genomic Location (Zv9):
Chromosome 17 (position 19174708)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 19324719
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAATGATGTCGTACATGAACGTGGGCACCTTGTCCAGAACCGAGCTA[C/T]AGCTGCTCAACCAGCTACACTGTCGGCGCAAGAGACGACACCGAACCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link