LOC100330886

Ensembl ID:
ENSDARG00000059067
Human Orthologue:
JUP
Human Description:
junction plakoglobin [Source:HGNC Symbol;Acc:6207]
Mouse Orthologues:
AC165274.1, Jup
Mouse Description:
junction plakoglobin Gene [Source:MGI Symbol;Acc:MGI:96650]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23428 Nonsense Mutation detected in F1 DNA During 2014
sa17365 Nonsense Available for shipment Available now
sa17166 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23428
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082080 Nonsense 100 733 4 16
Genomic Location:
Chromosome 19 (position 6171305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACCCTGGTGGAGGGAGAGACGGTTCTCACACCGCAGAGCAACCCAGAC[C/T]AGCCCACTAATGTGCAGAGACTGGCGGAGCCCTCACAGCTGCTGAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17365
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082080 Nonsense 386 733 9 16
Genomic Location:
Chromosome 19 (position 6192270)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGCTCTTCTGGCTTTATTTGTGTTCAGGAAGGTCTGGACGGTCTGCTG[C/T]AGAWCTTAGTGAGTCAGCTGGGCTCTGATGAWGTCAACWTGCTGACCTGY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17166
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082080 Nonsense 716 733 15 16
Genomic Location:
Chromosome 19 (position 6217313)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTACCCATGGACGGCCTCCCGCTGGAMGCTGAGCTTCATGAGCAATA[C/A]ATGCCAGAAATGGCCTACGACCCTCGACAGGTGTATCCAAATCCTCTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/30qn7gha