ft2

Ensembl ID:
ENSDARG00000059055
ZFIN ID:
ZDB-GENE-990715-18
Description:
alpha(1,3)fucosyltransferase gene 2 [Source:RefSeq peptide;Acc:NP_001122245]
Human Orthologue:
FUT9
Human Description:
fucosyltransferase 9 (alpha (1,3) fucosyltransferase) [Source:HGNC Symbol;Acc:4020]
Mouse Orthologue:
Fut9
Mouse Description:
fucosyltransferase 9 Gene [Source:MGI Symbol;Acc:MGI:1330859]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36768 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36768
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082065 Nonsense 117 405 2 2
Genomic Location (Zv9):
Chromosome 19 (position 6263586)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5722643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCGCCAAATCCTGCTAAAGAGGATCAAGACATCATCGTGTTGATCTG[G/A]ATGGCTCCTTTTGGAGTACGTTTTGATTTGAAAGATTGTGGCTCAGAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link