pdk2

Ensembl ID:
ENSDARG00000059054
ZFIN ID:
ZDB-GENE-040426-939
Description:
[Source:RefSeq peptide;Acc:NP_957290]
Human Orthologue:
PDK2
Human Description:
pyruvate dehydrogenase kinase, isozyme 2 [Source:HGNC Symbol;Acc:8810]
Mouse Orthologue:
Pdk2
Mouse Description:
pyruvate dehydrogenase kinase, isoenzyme 2 Gene [Source:MGI Symbol;Acc:MGI:1343087]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8990 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042189 Essential Splice Site 203 409 None 11
ENSDART00000114739 Essential Splice Site 203 409 None 12

The following transcripts of ENSDARG00000059054 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 6303678)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5762533
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTTAGCGACAARTGCAGACTCARYGATGATGTCCCGTGTTCTGCTTC[A/T]GATGCCTATGAGAGCGCTAAAATGCTCTGTGAACAGAATTACCTCGGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link