LOC100329459

Ensembl ID:
ENSDARG00000059052
Human Orthologue:
SLC25A29
Human Description:
solute carrier family 25, member 29 [Source:HGNC Symbol;Acc:20116]
Mouse Orthologue:
Slc25a29
Mouse Description:
solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29 Gene [So

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30393 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082061 Nonsense 124 302 5 5
Genomic Location (Zv9):
Chromosome Zv9_NA92 (position 21542)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1480943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGCGTGATCTGCTGCCCGATGGAGCTGGCCAAGACCCGTATGCAGATG[C/T]AGGGCACGGGCGAGAAGAGCTTATCCCGCCGGCTCTACAGGAACTCCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link