si:ch1073-93e12.2

Ensembl ID:
ENSDARG00000059044
ZFIN ID:
ZDB-GENE-100922-143
Human Orthologue:
EPM2A
Human Description:
epilepsy, progressive myoclonus type 2A, Lafora disease (laforin) [Source:HGNC Symbol;Acc:3413]
Mouse Orthologue:
Epm2a
Mouse Description:
epilepsy, progressive myoclonic epilepsy, type 2 gene alpha Gene [Source:MGI Symbol;Acc:MGI:1341085]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17655 Essential Splice Site Available for shipment Available now
sa24236 Nonsense Available for shipment Available now
sa13005 Nonsense Available for shipment Available now
sa24235 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17655
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082045 Essential Splice Site 142 322 3 5
ENSDART00000136436 Essential Splice Site 141 310 3 5
Genomic Location (Zv9):
Chromosome 23 (position 1571705)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACTTCTACTTCAGYATAGCMGGACAGCAGGCCATGCACTTCTCTCAG[T/G]AYGTGCGAATAAACTTCCTATCCTYTAGGTCAGGRCTATCAGTCCTTTNAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082045 Nonsense 185 322 4 5
ENSDART00000136436 Nonsense 184 310 4 5
Genomic Location (Zv9):
Chromosome 23 (position 1551276)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1519651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCACGGCGGTGATGAACTTTCAGACCGAGTGGGACGTGATAAACAACT[C/A]GCACGGCTGCCGGCGAGACCTCAGTCAACCCATGACCCCCGAGACCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082045 Nonsense 267 322 5 5
ENSDART00000136436 Nonsense 266 310 5 5
Genomic Location (Zv9):
Chromosome 23 (position 1549358)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1517733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGCAGGAGTGGGTCGCWCCACTGCTGCCGTCTGTGGACTTCTCATGTA[C/A]GTGTTCGGGTGGAAACTCAGGAAAGTGCAGTACTTCCYCACCGCCAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082045 Nonsense 271 322 5 5
ENSDART00000136436 Nonsense 270 310 5 5
Genomic Location (Zv9):
Chromosome 23 (position 1549346)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1517721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCGCTCCACTGCTGCCGTCTGTGGACTTCTCATGTACGTGTTCGGGTG[G/A]AAACTCAGGAAAGTGCAGTACTTCCTCACCGCCAGAAGGGCGGCAGTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link