LOC100333752

Ensembl ID:
ENSDARG00000059032
Mouse Orthologue:
Gm1123
Mouse Description:
predicted gene 1123 Gene [Source:MGI Symbol;Acc:MGI:2685969]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30462 Nonsense Mutation detected in F1 DNA During 2016
sa39511 Nonsense Mutation detected in F1 DNA During 2016
sa19383 Nonsense Mutation detected in F1 DNA During 2016
sa44404 Nonsense Mutation detected in F1 DNA During 2016
sa39510 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa30462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082033 Nonsense 114 634 2 15
Genomic Location:
Chromosome Zv9_NA303 (position 52327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCCGTCTGGATGATCTGAGAGCTGATGATAAAGGGCTGTACAGGTG[T/A]AAAGTGTACAGTCAGCGGGATGCTGGTGCAACTCTGGTTGAAATTAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082033 Nonsense 195 634 3 15
Genomic Location:
Chromosome Zv9_NA303 (position 49216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCCAGCTTCTGCATTTTGAAAAGAGCGCAGTGATTCCTGCAGATGAG[C/T]GATACAGAGAGCGCGTGGTGTTTTTCCCCTCTGAAATCCCCAAAGGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082033 Nonsense 374 634 8 15
Genomic Location:
Chromosome Zv9_NA303 (position 38700)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAATGTCTTCTTTCTTTTCCTAGTTCTGTTTTTTAAATATGCTCTGGAT[C/T]AAAGTTGGCAATCTACAGTTTTCATCGTAGTCTCAGTAGGACTTTCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44404
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082033 Nonsense 423 634 9 15
Genomic Location:
Chromosome Zv9_NA303 (position 36487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGCCTGGAGAAATAATGATCCACAGTCACAAATACTGCACGCAGTTT[T/A]GGAGGGGATGCTGGCAATATTAGGCATGCTTATTATGGGAGGTCTCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39510
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082033 Essential Splice Site 534 634 12 15
Genomic Location:
Chromosome Zv9_NA303 (position 28708)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATACAGTGGACACTTATGGATTTGACCTGGGCGTTTAACAAATCAG[G/A]TACAGTAATGATCATCATCTTTTTGTATCCCTGTATTTCCAACACAATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link