LOC100005670

Ensembl ID:
ENSDARG00000059029
Mouse Orthologue:
Mmp28
Mouse Description:
matrix metallopeptidase 28 (epilysin) Gene [Source:MGI Symbol;Acc:MGI:2153062]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32011 Nonsense Available for shipment Available now
sa22571 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082026 Nonsense 384 501 8 8
Genomic Location (Zv9):
Chromosome 15 (position 1794485)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1841607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGTCAGGACGTCGGATGTGGCGTTACTCCGGATCTAATCTGGACCCT[G/T]GATTCCCCAAGAGGAGCAGTGCATTGGGTTTGCCTAAACACGTAGACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082026 Nonsense 445 501 8 8
Genomic Location (Zv9):
Chromosome 15 (position 1794302)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1841424
KASP Assay ID:
2260-8040.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCTGTACTACCCTCGTCCTCTGAGGGACTGGAAGGGGGTCCCGCGA[G/T]AGGTAAACGGGGCCCTGACAAGGCCTGACGGGATGCTTTATTTCTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link