otud5a

Ensembl ID:
ENSDARG00000059006
ZFIN ID:
ZDB-GENE-030616-61
Description:
OTU domain-containing protein 5-A [Source:UniProtKB/Swiss-Prot;Acc:Q08BW0]
Human Orthologue:
OTUD5
Human Description:
OTU domain containing 5 [Source:HGNC Symbol;Acc:25402]
Mouse Orthologue:
Otud5
Mouse Description:
OTU domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1859615]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34303 Nonsense Mutation detected in F1 DNA During 2017
sa41124 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34304 Nonsense Mutation detected in F1 DNA During 2017
sa21204 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081999   None 464 2 10
ENSDART00000139150   None 283 None 7
ENSDART00000144986 Nonsense 76 560 1 9
Genomic Location (Zv9):
Chromosome 8 (position 9406164)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8822746
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCGCCGGCGTCCAGAGAGGACAGGCGAACTGAATCCAGCTCCCGGCCG[C/T]AGCAGGCCTCTCCTCCGCCGGTGGGTGCCGGGTCCTCGGGTGGCCCCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081999 Essential Splice Site 100 464 None 10
ENSDART00000139150   None 283 None 7
ENSDART00000144986 Essential Splice Site 196 560 None 9
Genomic Location (Zv9):
Chromosome 8 (position 9406528)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8823110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGAATGCTTCCAGACTACAGTCAGAGGACCCAGCGACTGTTGAACAGG[T/A]ATGTGGATGGATGATGTCACCTAATGCTGAGAGTCATAAACAACTGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34304
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081999 Nonsense 163 464 5 10
ENSDART00000139150 Nonsense 23 283 3 7
ENSDART00000144986 Nonsense 259 560 4 9
Genomic Location (Zv9):
Chromosome 8 (position 9449845)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8866427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGCGATATTTGCTTGCAGATGAAAAATGCAGATTACTTCTCAAACTA[T/A]GTGACAGAGGACTTCACTACATACATCAACAGAAAGAGGAAGAACAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21204
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081999 Nonsense 342 464 8 10
ENSDART00000139150 Nonsense 202 283 6 7
ENSDART00000144986 Nonsense 438 560 7 9
Genomic Location (Zv9):
Chromosome 8 (position 9463843)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8880425
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTCTGCCACGGCTGCGGCCTCCAGTGGTTTGGAAGAATGGAATGCT[C/T]GATCTCCACGGCAACGAAGCTCCGCCCCTTCTCCGGAGATTCCTGATCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link