LOC556392

Ensembl ID:
ENSDARG00000059003
Human Orthologue:
FAM40B
Human Description:
family with sequence similarity 40, member B [Source:HGNC Symbol;Acc:22209]
Mouse Orthologue:
Fam40b
Mouse Description:
family with sequence similarity 40, member B Gene [Source:MGI Symbol;Acc:MGI:2444363]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40212 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20192 Essential Splice Site Available for shipment Available now
sa761 Essential Splice Site F2 line generated During 2016
sa33370 Nonsense Mutation detected in F1 DNA During 2016
sa20191 Nonsense Available for shipment Available now
sa441 Nonsense Confirmed mutation in F2 line During 2016

Mutation Details

Allele Name:
sa40212
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Essential Splice Site 423 810 12 22
Genomic Location (Zv9):
Chromosome 4 (position 4857675)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4975856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTTCTGGAGACCAGCAGAAACAAATTCATCGGCTTCACCTTGGGAAA[G/A]TGAGTCTCTGATCAATTCTCCCAGGCCACTAAGCTTATGAATCCATGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Essential Splice Site 423 810 13 22
Genomic Location (Zv9):
Chromosome 4 (position 4857558)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4975739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCATCATCATTAAATCAATATACAGTTTTCTTTCTGATCTTATTTC[A/T]GTGACATCGACACTCTGGTTGGGTTGCCCAGACCTATACACGAGAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa761
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Essential Splice Site 468 810 14 22
Genomic Location (Zv9):
Chromosome 4 (position 4856553)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4974734
KASP Assay ID:
554-0667.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCAGATCAAGAGRGAGGACGAGCTCCAGCAGTGCCCCATGACTATGG[T/A]AAGTGCCTTASACACGTCATRCTTTTTATGCATTTCTTACTGKTCCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Nonsense 696 810 21 22
Genomic Location (Zv9):
Chromosome 4 (position 4846804)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4964985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGATGCAGCTCTATGTCCTCAAACTACTCAAGATCCAGACCAAGTATT[T/A]GGGACGACAGTGGAGAAAGAGTAACATGAAAACCATGTCTGCCATCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20191
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Nonsense 716 810 21 22
Genomic Location (Zv9):
Chromosome 4 (position 4846745)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4964926
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGAGAAAGAGTAACATGAAAACCATGTCTGCCATCTACCAGAAAGTC[A/T]GACATCGACTCAATGACGACTGGGCATATGGAAACGGTAAAAGTCTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa441
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Nonsense 755 810 22 22
Genomic Location (Zv9):
Chromosome 4 (position 4846401)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 4964582
KASP Assay ID:
554-0294.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGTGTGCGTTACGCGAGAGCATCGAGAAATTCAACACACGGCGCTA[T/A]GATAAGAATCAGAACAGTGAGTTTGCACCAGTGGACAATTGCCTTCAAAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link