LOC556392

Ensembl ID:
ENSDARG00000059003
Human Orthologue:
FAM40B
Human Description:
family with sequence similarity 40, member B [Source:HGNC Symbol;Acc:22209]
Mouse Orthologue:
Fam40b
Mouse Description:
family with sequence similarity 40, member B Gene [Source:MGI Symbol;Acc:MGI:2444363]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20192 Essential Splice Site Available for shipment Available now
sa761 Essential Splice Site F2 line generated During 2014
sa20191 Nonsense Mutation detected in F1 DNA During 2014
sa441 Nonsense Confirmed mutation in F2 line During 2014

Mutation Details

Allele Name:
sa20192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Essential Splice Site 423 810 13 22
Genomic Location:
Chromosome 4 (position 4857558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCATCATCATTAAATCAATATACAGTTTTCTTTCTGATCTTATTTC[A/T]GTGACATCGACACTCTGGTTGGGTTGCCCAGACCTATACACGAGAGTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa761
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Essential Splice Site 468 810 14 22
Genomic Location:
Chromosome 4 (position 4856553)
KASP Assay ID:
554-0667.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCCAGATCAAGAGRGAGGACGAGCTCCAGCAGTGCCCCATGACTATGG[T/A]AAGTGCCTTASACACGTCATRCTTTTTATGCATTTCTTACTGKTCCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Nonsense 716 810 21 22
Genomic Location:
Chromosome 4 (position 4846745)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGAGAAAGAGTAACATGAAAACCATGTCTGCCATCTACCAGAAAGTC[A/T]GACATCGACTCAATGACGACTGGGCATATGGAAACGGTAAAAGTCTGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa441
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081990 Nonsense 755 810 22 22
Genomic Location:
Chromosome 4 (position 4846401)
KASP Assay ID:
554-0294.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGTGTGCGTTACGCGAGAGCATCGAGAAATTCAACACACGGCGCTA[T/A]GATAAGAATCAGAACAGTGAGTTTGCACCAGTGGACAATTGCCTTCAAAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sypykyb3