EVPL (2 of 2)

Ensembl ID:
ENSDARG00000059002
Description:
envoplakin [Source:HGNC Symbol;Acc:3503]
Human Orthologues:
EVPL, EVPLL
Human Descriptions:
envoplakin [Source:HGNC Symbol;Acc:3503]
envoplakin-like [Source:HGNC Symbol;Acc:35236]
Mouse Orthologue:
Evpl
Mouse Description:
envoplakin Gene [Source:MGI Symbol;Acc:MGI:107507]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6025 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6876 Nonsense Mutation detected in F1 DNA During 2014
sa15141 Nonsense Available for shipment Available now
sa19938 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082000 Essential Splice Site 71 1706 2 15
Genomic Location:
Chromosome 3 (position 6523444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRTCAGCTCTGAGAAACATGAGCAATCCTGAGATCCTGCTGCAGCTCGAG[G/A]TACRTATACACACACAYAAATACACGCGCATRCACATATATACTAGGRTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082000 Nonsense 448 1706 10 15
Genomic Location:
Chromosome 3 (position 6509523)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAACAGGGCAACTCTGTTGAAAGAAGCYGTCAGTAAGTACCAGGAGTTT[C/T]AGAGCGTCAACCAATCGCTCACTGCTTTCCTCATCAACATGCCCAACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082000 Nonsense 474 1706 10 15
Genomic Location:
Chromosome 3 (position 6509445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCATCAACATGCCCAACAACAAGGTGCAGCCTGGTGAAAGTATGACR[C/T]AAGTCTATGCCAAGCAAAACTCGCAGATGGTCAGTATTAAATTKKATTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19938
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082000 Nonsense 1110 1706 14 15
Genomic Location:
Chromosome 3 (position 6506944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTAGAACTGGAGGTGCAGCAGATGAGATCTGTAATCCTGGAACTGGAG[A/T]AAAAACTGGAGCTTGTGGATCGACAGAAGAAGGTAATGGTTGAGACAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vyfjcstz