pim2

Ensembl ID:
ENSDARG00000059001
ZFIN ID:
ZDB-GENE-000831-6
Description:
Serine/threonine-protein kinase pim-2 [Source:UniProtKB/Swiss-Prot;Acc:Q9YHZ5]
Human Orthologue:
PIM2
Human Description:
pim-2 oncogene [Source:HGNC Symbol;Acc:8987]
Mouse Orthologue:
Pim2
Mouse Description:
proviral integration site 2 Gene [Source:MGI Symbol;Acc:MGI:97587]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12616 Nonsense Available for shipment Available now
sa9268 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12616
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081985 Nonsense 60 310 3 7

The following transcripts of ENSDARG00000059001 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 9473407)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8889989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRCATTCCTCTTCTAAATTATGGTTATTATTATTTTAGGTTGCTATCAAA[C/T]AAATATCMCGAGACAGAATCCAACAGTGGWCAAAAATGGTGAGTATTCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081985 Nonsense 226 310 6 7

The following transcripts of ENSDARG00000059001 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 9475849)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 8892431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGAGTGGATCCTTTACCACAAATACCACGCTCTTCCGCTCACTGTGTG[G/A]TCATTGGGTGTSCTCCTGTACGATATGGTKTGTGGAGACATTCCCTTTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link