cdx1b

Ensembl ID:
ENSDARG00000058999
ZFIN ID:
ZDB-GENE-070615-29
Description:
homeobox protein CDX-1 [Source:RefSeq peptide;Acc:NP_001092232]
Human Orthologue:
CDX1
Human Description:
caudal type homeobox 1 [Source:HGNC Symbol;Acc:1805]
Mouse Orthologue:
Cdx1
Mouse Description:
caudal type homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:88360]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3143 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081993 Nonsense 37 255 1 3
Genomic Location:
Chromosome 21 (position 42543309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAGCCTAAATTTAAACCCTCAGAATTTCGTACCGGCGCCTCCACAGTA[T/A]CCGGACTTTACAGGWTACCATCACGTCCCGGGAATTACCACTAATGACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hclmin3h