jam2a

Ensembl ID:
ENSDARG00000058996
ZFIN ID:
ZDB-GENE-031204-3
Description:
junctional adhesion molecule 2a [Source:RefSeq peptide;Acc:NP_001091734]
Human Orthologue:
JAM2
Human Description:
junctional adhesion molecule 2 [Source:HGNC Symbol;Acc:14686]
Mouse Orthologue:
Jam2
Mouse Description:
junction adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:1933820]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu3319 Nonsense Confirmed mutation in F2 line Unknown
sa39528 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
hu3319
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081989 Nonsense 40 307 3 13
ENSDART00000133165   None 98 None 4
ENSDART00000135944 Nonsense 40 185 3 5
Genomic Location (Zv9):
Chromosome 1 (position 476576)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 606700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGATGAGCTCTAAAATCTGTCTCTGTCCACAGACGCAGAGCTCTCCTG[C/A]GAGTTCAAGACTGAGAAAGACACCAACCCTCGCATCGAGTGGAAGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081989 Essential Splice Site 215 307 8 13
ENSDART00000133165   None 98 None 4
ENSDART00000135944   None 185 None 5
Genomic Location (Zv9):
Chromosome 1 (position 478673)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 608797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTAAAGCACCCTAGCAACCACATTCTGAAAACTCAGAACATTCGTTTA[T/A]ATTCATATGATAATAAAGGCCTGTGCTGCGTTTTGGAATCAACAGAATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link