GPR77

Ensembl ID:
ENSDARG00000058991
Description:
G protein-coupled receptor 77 [Source:HGNC Symbol;Acc:4527]
Human Orthologues:
GPR152, GPR77
Human Descriptions:
G protein-coupled receptor 152 [Source:HGNC Symbol;Acc:23622]
G protein-coupled receptor 77 [Source:HGNC Symbol;Acc:4527]
Mouse Orthologues:
Gpr152, Gpr77
Mouse Descriptions:
G protein-coupled receptor 152 Gene [Source:MGI Symbol;Acc:MGI:2685519]
G protein-coupled receptor 77 Gene [Source:MGI Symbol;Acc:MGI:2442013]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9162 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102431 Nonsense 365 369 2 2
Genomic Location (Zv9):
Chromosome 1 (position 426989)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 557113
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTCAACGAGGAGTTATCAGAGTCTTTACGAAGAAAATCCCTACGAAGG[A/T]GAGACTCTCAGTTTTAGAGGAGCATCAAGAGGCGAATTTCAATTAYAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link