GGA3 (1 of 2)

Ensembl ID:
ENSDARG00000058987
Description:
golgi-associated, gamma adaptin ear containing, ARF binding protein 3 [Source:HGNC Symbol;Acc:17079]
Human Orthologue:
GGA3
Human Description:
golgi-associated, gamma adaptin ear containing, ARF binding protein 3 [Source:HGNC Symbol;Acc:17079]
Mouse Orthologue:
Gga3
Mouse Description:
golgi associated, gamma adaptin ear containing, ARF binding protein 3 Gene [Source:MGI Symbol;Acc:MG

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16740 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081977 Nonsense 431 686 12 16
Genomic Location:
Chromosome 3 (position 6911562)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCCTCTGTGCCAAACAGACCAAAGCTGGATGATTTATCTGCTCAGTG[G/A]ACGTCTCTACAGGTAGCACACACTAAACTCCAGATCTTCAGAGCGTATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7jmcxoyd