GGA3 (1 of 2)

Ensembl ID:
ENSDARG00000058987
Description:
golgi-associated, gamma adaptin ear containing, ARF binding protein 3 [Source:HGNC Symbol;Acc:17079]
Human Orthologue:
GGA3
Human Description:
golgi-associated, gamma adaptin ear containing, ARF binding protein 3 [Source:HGNC Symbol;Acc:17079]
Mouse Orthologue:
Gga3
Mouse Description:
golgi associated, gamma adaptin ear containing, ARF binding protein 3 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33086 Nonsense Mutation detected in F1 DNA During 2016
sa16740 Nonsense Available for shipment Available now
sa38371 Splice Site, Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081977 Nonsense 242 686 8 16
Genomic Location (Zv9):
Chromosome 3 (position 6903043)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6622194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACGTCAAGCTCCTGACTGAAATGCTGAGTCAATATGACAGAGAGCGAT[C/A]GTCAGACGCCGACCGTGAGCTCATCAAGGTGAGAGCACACAAATAGCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16740
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081977 Nonsense 431 686 12 16
Genomic Location (Zv9):
Chromosome 3 (position 6911562)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6613674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCCCTCTGTGCCAAACAGACCAAAGCTGGATGATTTATCTGCTCAGTG[G/A]ACGTCTCTACAGGTAGCACACACTAAACTCCAGATCTTCAGAGCGTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081977 Splice Site, Nonsense 636 686 15 16
Genomic Location (Zv9):
Chromosome 3 (position 6916477)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6608755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGGCACCGCTGCCCGTGAGGAATGTAGTTCTGCAAGCAGCCGTGCCC[A/T]AGGTAAAACACTTGCGCCTGCAACACACACATTCACACAGAGTCAGATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link