cyp1c1

Ensembl ID:
ENSDARG00000058980
ZFIN ID:
ZDB-GENE-050522-501
Description:
cytochrome P450, family 1, subfamily C, polypeptide 1 [Source:RefSeq peptide;Acc:NP_001018446]
Human Orthologue:
CYP1B1
Human Description:
cytochrome P450, family 1, subfamily B, polypeptide 1 [Source:HGNC Symbol;Acc:2597]
Mouse Orthologue:
Cyp1b1
Mouse Description:
cytochrome P450, family 1, subfamily b, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:88590]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24773 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019953 Nonsense 115 523 1 1
Genomic Location:
Chromosome Zv9_NA892 (position 104157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCGGCGATAAGGAAGGCACTGGTTCAACACAGCACCGAGTTCGCAGGA[C/T]GACCCAATTTTGTGTCTTTTCAGATGATTTCCGGCGGGCGAAGTTTAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c9wu3phx