LOC559157

Ensembl ID:
ENSDARG00000058969
Human Orthologues:
AL953854.2, CNTNAP1, CNTNAP3, CNTNAP3B, CNTNAP4, CNTNAP5
Human Descriptions:
contactin associated protein 1 [Source:HGNC Symbol;Acc:8011]
contactin associated protein-like 3 [Source:HGNC Symbol;Acc:13834]
contactin associated protein-like 3B [Source:HGNC Symbol;Acc:32035]
contactin associated protein-like 4 [Source:HGNC Symbol;Acc:18747]
contactin associated protein-like 5 [Source:HGNC Symbol;Acc:18748]
Novel protein similar to contactin associated protein-like 3 (CNTNAP3) [Source:UniProtKB/TrEMBL;Acc:
Mouse Orthologues:
Cntnap1, Cntnap3, Cntnap4, Cntnap5a, Cntnap5b, Cntnap5c
Mouse Descriptions:
contactin associated protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1858201]
contactin associated protein-like 3 Gene [Source:MGI Symbol;Acc:MGI:3588199]
contactin associated protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2183572]
contactin associated protein-like 5A Gene [Source:MGI Symbol;Acc:MGI:3643623]
contactin associated protein-like 5B Gene [Source:MGI Symbol;Acc:MGI:3664583]
contactin associated protein-like 5C Gene [Source:MGI Symbol;Acc:MGI:3646013]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44118 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa44117 Nonsense Mutation detected in F1 DNA During 2016
sa10552 Essential Splice Site Available for shipment Available now
sa37859 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44118
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081960 Splice Site, Nonsense 51 1118 1 20
Genomic Location (Zv9):
Chromosome 24 (position 18375657)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17682133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCACCTTGGAGTTGAGAAGAGGCCGACTTCTGCTGCAGATAAACCTC[G/T]GTAAAACTCAGACCTGACATCTACTGCACACTCTTAAAAATAAAGCTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081960 Nonsense 221 1118 4 20
Genomic Location (Zv9):
Chromosome 24 (position 18360302)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17666778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCAGCGGCCTGCTCCTGTTTAGCTCCTTGGCAGATGGAATGCTGGAAT[T/A]GGCTCTAAACGATGGAAAAGTCACAGCACACATTAACGTCACCCAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081960 Essential Splice Site 246 1118 4 20
Genomic Location (Zv9):
Chromosome 24 (position 18360224)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17666700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACATTAACGTCACCCAGCAGAAAAACATGCGTGTGGACATTGCKTCAG[G/A]TGAGCTGACATTCTTCCCCCACATAAACTCAATTKCTATTACATACAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081960 Nonsense 334 1118 6 20
Genomic Location (Zv9):
Chromosome 24 (position 18303589)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 17610065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCAGGTGGATGATCAGCTGGCAGACCTGACCGCAGTAGAGCAGGGA[A/T]GAATCGGAGCCTTCGAAAACGTCAGCCTGGACATGTGTGCCATCATTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link