LOC559157

Ensembl ID:
ENSDARG00000058969
Human Orthologues:
AL953854.2, CNTNAP1, CNTNAP3, CNTNAP3B, CNTNAP4, CNTNAP5
Human Descriptions:
contactin associated protein 1 [Source:HGNC Symbol;Acc:8011]
contactin associated protein-like 3 [Source:HGNC Symbol;Acc:13834]
contactin associated protein-like 3B [Source:HGNC Symbol;Acc:32035]
contactin associated protein-like 4 [Source:HGNC Symbol;Acc:18747]
contactin associated protein-like 5 [Source:HGNC Symbol;Acc:18748]
Novel protein similar to contactin associated protein-like 3 (CNTNAP3) [Source:UniProtKB/TrEMBL;Acc:
Mouse Orthologues:
Cntnap1, Cntnap3, Cntnap4, Cntnap5a, Cntnap5b, Cntnap5c
Mouse Descriptions:
contactin associated protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:1858201]
contactin associated protein-like 3 Gene [Source:MGI Symbol;Acc:MGI:3588199]
contactin associated protein-like 4 Gene [Source:MGI Symbol;Acc:MGI:2183572]
contactin associated protein-like 5A Gene [Source:MGI Symbol;Acc:MGI:3643623]
contactin associated protein-like 5B Gene [Source:MGI Symbol;Acc:MGI:3664583]
contactin associated protein-like 5C Gene [Source:MGI Symbol;Acc:MGI:3646013]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10552 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081960 Essential Splice Site 246 1118 4 20
Genomic Location:
Chromosome 24 (position 18360224)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACATTAACGTCACCCAGCAGAAAAACATGCGTGTGGACATTGCKTCAG[G/A]TGAGCTGACATTCTTCCCCCACATAAACTCAATTKCTATTACATACAGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aie9a2un