haus1

Ensembl ID:
ENSDARG00000058968
ZFIN ID:
ZDB-GENE-091204-387
Description:
Ccdc5 protein [Source:UniProtKB/TrEMBL;Acc:Q566U6]
Human Orthologue:
HAUS1
Human Description:
HAUS augmin-like complex, subunit 1 [Source:HGNC Symbol;Acc:25174]
Mouse Orthologue:
Haus1
Mouse Description:
HAUS augmin-like complex, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:2385076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa29505 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29505
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081954 Essential Splice Site 15 286 None 9

The following transcripts of ENSDARG00000058968 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 5316894)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 4913038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACATGCAACACACGTTTACAGGAAACATGTGCGAGAAAAGCAAAATCG[T/G]GAGTTGATATCTTTGTGAATAATATAAACTAATGTAATCTATTTAAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link