abcc4

Ensembl ID:
ENSDARG00000058953
ZFIN ID:
ZDB-GENE-030616-511
Description:
multidrug resistance-associated protein 4 [Source:RefSeq peptide;Acc:NP_001007039]
Human Orthologue:
ABCC4
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 4 [Source:HGNC Symbol;Acc:55]
Mouse Orthologue:
Abcc4
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 4 Gene [Source:MGI Symbol;Acc:MGI:2443111]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38538 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20625 Essential Splice Site Available for shipment Available now
sa16292 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa38538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065500 Essential Splice Site 102 1327 3 30
Genomic Location:
Chromosome 6 (position 7253402)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCTACTGGAAATCTTATGCAGTTCTGGGAGTGTTTACTCTTATTGAG[G/A]TACGTTCTGAACTGGAACTAACACCTATCTGTATGTCTTGGTAAATGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065500 Essential Splice Site 304 1327 7 30
Genomic Location:
Chromosome 6 (position 7267408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTATGCCTGGGAGAAGCCGTTCGCCATGCTGGTTAATGATGTACGAAG[G/A]TAAATTACATAGACTTATTGAGTCTGTTTGCACTGCTGTAGCTTGCGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065500 Essential Splice Site 518 1327 12 30
Genomic Location:
Chromosome 6 (position 7279080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTAAGCTGTAGTGTACWGYAGTAATACTGTGGTTCTGTCTGTGGTACA[G/A]GACATGGAGCTGCTTCCTGAYGGGGATTTGACAGTGATTGGAGACCGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link