abcc4

Ensembl ID:
ENSDARG00000058953
ZFIN ID:
ZDB-GENE-030616-511
Description:
multidrug resistance-associated protein 4 [Source:RefSeq peptide;Acc:NP_001007039]
Human Orthologue:
ABCC4
Human Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 4 [Source:HGNC Symbol;Acc:55]
Mouse Orthologue:
Abcc4
Mouse Description:
ATP-binding cassette, sub-family C (CFTR/MRP), member 4 Gene [Source:MGI Symbol;Acc:MGI:2443111]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20625 Essential Splice Site Available for shipment Available now
sa16292 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20625
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065500 Essential Splice Site 304 1327 7 30
Genomic Location:
Chromosome 6 (position 7267408)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTATGCCTGGGAGAAGCCGTTCGCCATGCTGGTTAATGATGTACGAAG[G/A]TAAATTACATAGACTTATTGAGTCTGTTTGCACTGCTGTAGCTTGCGATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065500 Essential Splice Site 518 1327 12 30
Genomic Location:
Chromosome 6 (position 7279080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTAAGCTGTAGTGTACWGYAGTAATACTGTGGTTCTGTCTGTGGTACA[G/A]GACATGGAGCTGCTTCCTGAYGGGGATTTGACAGTGATTGGAGACCGGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tn4gclq2