LOC100148621

Ensembl ID:
ENSDARG00000058950
Human Orthologue:
CSPP1
Human Description:
centrosome and spindle pole associated protein 1 [Source:HGNC Symbol;Acc:26193]
Mouse Orthologue:
Cspp1
Mouse Description:
centrosome and spindle pole associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:2681832]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8396 Nonsense Mutation detected in F1 DNA During 2014
sa3270 Nonsense F2 line generated During 2014
sa24474 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8396
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081919 Nonsense 464 1134 11 28
ENSDART00000081919 Nonsense 464 1134 11 28
Genomic Location:
Chromosome 24 (position 19234129)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGKCCCTCCCTCAATGAGTCCTATCAAACGCCTTATGATAATGCATA[T/G]TACTATTATGGAGCCAGAAATCCTCTAGATCCCAATCTGGCCTACTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3270
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081919 Nonsense 464 1134 11 28
ENSDART00000081919 Nonsense 464 1134 11 28
Genomic Location:
Chromosome 24 (position 19234129)
KASP Assay ID:
554-3094.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGKCCCTCCCTCAATGAGTCCTATCAAACGCCTTATGATAATGCATA[T/A]TACTATTATGGAGCCAGAAATCCTCTAGATCCCAATCTGGCCTACTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081919 Nonsense 1025 1134 27 28
Genomic Location:
Chromosome 24 (position 19273330)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGACTGTACTATTGTTTTGACGCTAGGATGTGGTAAACGGGTACACT[C/T]GACCTGACAGCGCTCCTGACAGCCAGTCCCTGCACTCGCTAACCATCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f9irzen1