LOC100332313

Ensembl ID:
ENSDARG00000058946
Human Orthologues:
MYO3A, MYO3B
Human Descriptions:
myosin IIIA [Source:HGNC Symbol;Acc:7601]
myosin IIIB [Source:HGNC Symbol;Acc:15576]
Mouse Orthologue:
Myo3a
Mouse Description:
myosin IIIA Gene [Source:MGI Symbol;Acc:MGI:2183924]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41569 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101012 Nonsense 171 253 5 7
Genomic Location (Zv9):
Chromosome 10 (position 2664125)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2609863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCACCGTGTGTTTGTTTCTGTTTCAGGGTCAGTTTGGCGTCCAGGAA[G/T]AAGACCTGCTGAAGAGTCTGACCTGCACCACGTCAATGACTCGAGGAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link