ENSDARG00000058941

Ensembl ID:
ENSDARG00000058941
Human Orthologues:
PCDHGC4, PCDHGC5
Human Descriptions:
protocadherin gamma subfamily C, 4 [Source:HGNC Symbol;Acc:8717]
protocadherin gamma subfamily C, 5 [Source:HGNC Symbol;Acc:8718]
Mouse Orthologue:
Pcdhga11
Mouse Description:
protocadherin gamma subfamily A, 11 Gene [Source:MGI Symbol;Acc:MGI:1935228]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12288 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081912 Nonsense 278 888 1 3
Genomic Location:
Chromosome 14 (position 3026407)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTGGACTCTGGYGTAAACGGGAAGATATCCTACTCATTCAGTAAGTA[C/A]ACTCCAGAGAGAAWACTGAAGATGTTCAGCGTCGATTCTAAAKCGGGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/fl1pxenq