si:ch211-248e11.2

Ensembl ID:
ENSDARG00000058940
ZFIN ID:
ZDB-GENE-081104-197
Description:
UPF0691 protein C9orf116 homolog [Source:UniProtKB/Swiss-Prot;Acc:B0UXH9]
Human Orthologue:
C9orf116
Human Description:
chromosome 9 open reading frame 116 [Source:HGNC Symbol;Acc:28435]
Mouse Orthologue:
1700007K13Rik
Mouse Description:
RIKEN cDNA 1700007K13 gene Gene [Source:MGI Symbol;Acc:MGI:1916577]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10375 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081909 Nonsense 114 137 3 3

The following transcripts of ENSDARG00000058940 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 12060942)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11505705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACAGAGACAACGGCTTCAACACCATGVTGGACAAGARTCGACTCTCC[A/T]GACCCAACGAAACGTCTGTGTTTTATGATAGAATCAATTTCCATTCCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link