si:ch1073-380l12.1

Ensembl ID:
ENSDARG00000058939
ZFIN ID:
ZDB-GENE-030131-8615
Description:
LOC553524 protein [Source:UniProtKB/TrEMBL;Acc:Q58EA8]
Human Orthologue:
B4GALNT3
Human Description:
beta-1,4-N-acetyl-galactosaminyl transferase 3 [Source:HGNC Symbol;Acc:24137]
Mouse Orthologue:
B4galnt3
Mouse Description:
beta-1,4-N-acetyl-galactosaminyl transferase 3 Gene [Source:MGI Symbol;Acc:MGI:3041155]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17326 Nonsense Available for shipment Available now
sa43036 Nonsense Mutation detected in F1 DNA During 2017
sa8410 Nonsense Mutation detected in F1 DNA During 2017
sa23215 Nonsense Available for shipment Available now
sa32185 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081904 Nonsense 95 440 4 15
ENSDART00000110892 Nonsense 95 1143 4 20
ENSDART00000129165 Nonsense 4 1052 1 17
Genomic Location (Zv9):
Chromosome 18 (position 5673816)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6447606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTATTGACTAATGGAAATTTCTSTTGTGTTTGCCRCAGTATAAAGGA[C/T]AAGCTAATCTTCACRTTTTCGACGACTGGTGTGGCTCRTCTATAGCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081904   None 440 None 15
ENSDART00000110892 Nonsense 513 1143 14 20
ENSDART00000129165 Nonsense 422 1052 11 17
Genomic Location (Zv9):
Chromosome 18 (position 5686625)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6460415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACAATGAACCCCAACCGAGAAGGAAGAAGAAAAGGAGACTGCCCCAA[C/T]AACAAAACCTGGAGGATCAACAACATCCTCAAAATGCACCTTCAGAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081904   None 440 None 15
ENSDART00000110892 Nonsense 628 1143 14 20
ENSDART00000129165 Nonsense 537 1052 11 17
Genomic Location (Zv9):
Chromosome 18 (position 5686970)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6460760
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATCTAAAGGAAAAATCCATAAAAAAAYCTGCCATGCTTAATGAGGTC[G/T]AGATTGAACATCCTGAATCRAATGGAATGGATAATCGGAAAGTCTTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081904   None 440 None 15
ENSDART00000110892 Nonsense 633 1143 14 20
ENSDART00000129165 Nonsense 542 1052 11 17
Genomic Location (Zv9):
Chromosome 18 (position 5686985)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6460775
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCATAAAAAAACCTGCCATGCTTAATGAGGTCGAGATTGAACATCCT[G/T]AATCGAATGGAATGGATAATCGGAAAGTCTTTCTTGGAGAACATGTCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081904   None 440 None 15
ENSDART00000110892 Nonsense 992 1143 17 20
ENSDART00000129165 Nonsense 901 1052 14 17
Genomic Location (Zv9):
Chromosome 18 (position 5692629)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6466419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCTCACTTTGACTTCCTTTCTATTGTGTGTCCTTTGATTCAGGTAT[C/T]AGTACCTCAGGTTGAGCGGAAACTTTGAGAGATCGGCCGGACTGCAGGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link