pou1f1

Ensembl ID:
ENSDARG00000058924
ZFIN ID:
ZDB-GENE-040630-7
Description:
pituitary-specific positive transcription factor 1 [Source:RefSeq peptide;Acc:NP_998016]
Human Orthologue:
POU1F1
Human Description:
POU class 1 homeobox 1 [Source:HGNC Symbol;Acc:9210]
Mouse Orthologue:
Pou1f1
Mouse Description:
POU domain, class 1, transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:97588]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8555 Nonsense Mutation detected in F1 DNA During 2017
sa41392 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081878 Nonsense 89 350 2 7
Genomic Location (Zv9):
Chromosome 9 (position 19762052)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19136294
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACTACCCGATRCCCCCATKTCACTATAGCAACCAGCAGACCACCTA[C/A]GGCATGATGGCAGGTACGTCAAGTTGCAACTGCGTCAACCATTGCTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41392
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081878 Nonsense 202 350 4 7
Genomic Location (Zv9):
Chromosome 9 (position 19756611)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19130853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGGACTCGCCTCAGATCCGAGAGCTGGAGAAGTTCGCTAATGACTTC[A/T]AATTAAGGAGGATCAAACTTGGTTTGTCTTTTGATTTCAGTTGCCCATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link