cep170l

Ensembl ID:
ENSDARG00000058892
ZFIN ID:
ZDB-GENE-050309-106
Description:
Novel protein similar to vertebrate centrosomal protein 170kDa (CEP170) [Source:UniProtKB/TrEMBL;Acc
Human Orthologue:
CEP170
Human Description:
centrosomal protein 170kDa [Source:HGNC Symbol;Acc:28920]
Mouse Orthologue:
Cep170
Mouse Description:
centrosomal protein 170 Gene [Source:MGI Symbol;Acc:MGI:1918348]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15942 Essential Splice Site Available for shipment Available now
sa33798 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081841 Essential Splice Site 485 1297 8 18
ENSDART00000137642 Essential Splice Site 485 1296 9 19

The following transcripts of ENSDARG00000058892 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 6389432)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6315448
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAAAATGGCAGTGCTGAGGTKGAAGAGGCCAGGCGTATGAYTGATAAG[G/A]TAAACCTGCAGAAGCATAAGATTTWGTTGTTGTTTGTGTGTATGTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081841 Essential Splice Site 1256 1297 None 18
ENSDART00000137642 Essential Splice Site 1255 1296 None 19

The following transcripts of ENSDARG00000058892 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 6 (position 6380467)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6306483
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGTTTTGGCACTTTTTATTCATTTTTTTTTTTTCATTTGATCACCCTC[A/G]GGAGATTTCCTCCATACTACAGAATCTGAAGAGAGTGGAGCGACAGCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link