si:ch211-256m12.5

Ensembl ID:
ENSDARG00000058885
ZFIN ID:
ZDB-GENE-100922-181
Human Orthologue:
TTC29
Human Description:
tetratricopeptide repeat domain 29 [Source:HGNC Symbol;Acc:29936]
Mouse Orthologue:
Ttc29
Mouse Description:
tetratricopeptide repeat domain 29 Gene [Source:MGI Symbol;Acc:MGI:1920551]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22741 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22741
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081826 Essential Splice Site 13 409 2 10
ENSDART00000148096   None 440 None 9
Genomic Location (Zv9):
Chromosome 16 (position 5441679)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4668232
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACCAACAGGACAACACCGACATCCAAGTAAACTCGTATTTTTCTCTC[A/T]TACTGAACGTTTTGCCTTCAAACAAAATGCGTGAATGTTTTTTTTTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link