mmp16b

Ensembl ID:
ENSDARG00000058876
ZFIN ID:
ZDB-GENE-061009-22
Description:
Novel protein similar to vertebrate matrix metallopeptidase 16 (Membrane-inserted) (MMP16) [Source:U
Human Orthologue:
MMP16
Human Description:
matrix metallopeptidase 16 (membrane-inserted) [Source:HGNC Symbol;Acc:7162]
Mouse Orthologue:
Mmp16
Mouse Description:
matrix metallopeptidase 16 Gene [Source:MGI Symbol;Acc:MGI:1276107]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5714 Nonsense Mutation detected in F1 DNA During 2016
sa31251 Nonsense Mutation detected in F1 DNA During 2016
sa6824 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081833 Nonsense 154 613 4 10
ENSDART00000146861 Nonsense 154 618 4 10
Genomic Location:
Chromosome 2 (position 4139324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGGAAATCARGAAACCCACGATGCGATCCGGCGGGCGTTTGACGTGT[G/A]GCAGGGAGTGACGCCGCTGCGCTTCGARGCCGTGCCCTTCCGTGACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081833 Nonsense 469 613 9 10
ENSDART00000146861 Nonsense 474 618 9 10
Genomic Location:
Chromosome 2 (position 4127826)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGGTACTGGAGGTACAATGAGGATATGAGGACGATGGACCCTGGATA[T/A]CCACAACCTATTACTGTGTGGAAAGGCATCCCAGACTCTCCACAGGGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081833 Nonsense 476 613 9 10
ENSDART00000146861 Nonsense 481 618 9 10
Genomic Location:
Chromosome 2 (position 4127806)
KASP Assay ID:
554-4201.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGATATGAGGACGATGGACCCTGGATATCCACAACCTATTACTGTGT[G/A]GAAAGGCATCCCAGACTCTCCACAGGGAGCATTCGTGGAYAAAGCCAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link