mmp16b

Ensembl ID:
ENSDARG00000058876
ZFIN ID:
ZDB-GENE-061009-22
Description:
Novel protein similar to vertebrate matrix metallopeptidase 16 (Membrane-inserted) (MMP16) [Source:U
Human Orthologue:
MMP16
Human Description:
matrix metallopeptidase 16 (membrane-inserted) [Source:HGNC Symbol;Acc:7162]
Mouse Orthologue:
Mmp16
Mouse Description:
matrix metallopeptidase 16 Gene [Source:MGI Symbol;Acc:MGI:1276107]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5714 Nonsense Mutation detected in F1 DNA During 2014
sa6824 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5714
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081833 Nonsense 154 613 4 10
ENSDART00000146861 Nonsense 154 618 4 10
Genomic Location:
Chromosome 2 (position 4139324)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGGGAAATCARGAAACCCACGATGCGATCCGGCGGGCGTTTGACGTGT[G/A]GCAGGGAGTGACGCCGCTGCGCTTCGARGCCGTGCCCTTCCGTGACCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081833 Nonsense 476 613 9 10
ENSDART00000146861 Nonsense 481 618 9 10
Genomic Location:
Chromosome 2 (position 4127806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGATATGAGGACGATGGACCCTGGATATCCACAACCTATTACTGTGT[G/A]GAAAGGCATCCCAGACTCTCCACAGGGAGCATTCGTGGAYAAAGCCAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rxjtzinn