pcdh2ac

Ensembl ID:
ENSDARG00000058875
ZFIN IDs:
ZDB-GENE-041118-11, ZDB-GENE-041118-12
Description:
protocadherin 2 alpha c [Source:RefSeq peptide;Acc:NP_001007763]
Human Orthologues:
AC010223.1, PCDHAC1, PCDHAC2
Human Descriptions:
protocadherin alpha subfamily C, 1 [Source:HGNC Symbol;Acc:8676]
protocadherin alpha subfamily C, 2 [Source:HGNC Symbol;Acc:8677]
protocadherin alpha-C1 isoform 2 precursor [Source:RefSeq peptide;Acc:NP_114088]
Mouse Orthologue:
Pcdha1
Mouse Description:
protocadherin alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2150982]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10954 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016582   None 1009 None 4
ENSDART00000050160 Nonsense 120 942 1 4
Genomic Location (Zv9):
Chromosome 14 (position 2739787)
KASP Assay ID:
2260-7165.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCATTGTTAATAATCCATTAAACCTGTTTCGYATTGAGATAAMTATTT[T/A]AGACATAAACGACAATTCTCCCTCTTTTCGTATACGTTCTAAGTTATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link