apc

Ensembl ID:
ENSDARG00000058868
ZFIN ID:
ZDB-GENE-031112-7
Description:
adenomatosis polyposis coli [Source:RefSeq peptide;Acc:NP_001137312]
Human Orthologue:
APC
Human Description:
adenomatous polyposis coli [Source:HGNC Symbol;Acc:583]
Mouse Orthologue:
Apc
Mouse Description:
adenomatosis polyposis coli Gene [Source:MGI Symbol;Acc:MGI:88039]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12033 Splice Site, Nonsense Available for shipment Available now
sa6136 Nonsense Mutation detected in F1 DNA During 2014
sa61 Nonsense Available for shipment Available now
sa21628 Nonsense Mutation detected in F1 DNA During 2014
sa9511 Nonsense Available for shipment Available now
sa7639 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044432 Splice Site, Nonsense 536 2755 13 16
Genomic Location:
Chromosome 10 (position 1911937)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGAGGGCCATGGTGGCTCAACTGAAGTCAGAAAGCGAGGACCTACAG[C/T]AGGTATTACTCTTTAGATATGCATTTCATATTCTTDAATTTTGTATTANTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044432 Nonsense 1293 2755 16 16
Genomic Location:
Chromosome 10 (position 1916178)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACTTTACCTATATCAGAAAAACAATCCACTAATAATGTTGCAGCTGAC[C/T]AACGCACATCTGAGAGCCAATCATCAGTCCATTATGTTCGCGCCAAGCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa61
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044432 Nonsense 1595 2755 16 16
Genomic Location:
Chromosome 10 (position 1917084)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGCAAACCGAGTCAGCTCCCTGTTTATAAATTATTGCCACCACAAAAC[A/T]GAGGGCAACCGCAGAAGCATGTGGCCCTAGCACACGGTGAGGACATGCCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa21628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044432 Nonsense 1900 2755 16 16
Genomic Location:
Chromosome 10 (position 1918001)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAAACAGTTTTTCCACAAGCACCCAAAGAAAATACTGTTGTGGTGTG[T/A]GATGAAAAGCAAAAGTTTTCCATTGAAGACACTCCTGTATGTTTTTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044432 Nonsense 2384 2755 16 16
Genomic Location:
Chromosome 10 (position 1919451)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCTTCAACAAAGTCTAGTGGTAGCGAGTCCGACCGCTCRGAGAAGCCT[G/T]GACTTGTTCGTCAATCAACATTTATCAAAGAAGCACCTAGTCCAACGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044432 Nonsense 2738 2755 16 16
Genomic Location:
Chromosome 10 (position 1920513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCTAGACCATCTCAGATCCCAACTCCGATTTCAAGCAATGCWAAAAWA[C/T]GAGACAYTAAAGGAGACACCACTGAAAGTGGGTCCTAYATCGTAAYCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hmghh8z2