ncl1

Ensembl ID:
ENSDARG00000058861
ZFIN ID:
ZDB-GENE-030131-8788
Description:
Nicalin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NZ07]
Human Orthologue:
NCLN
Human Description:
nicalin [Source:HGNC Symbol;Acc:26923]
Mouse Orthologue:
Ncln
Mouse Description:
nicalin homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1926081]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44981 Nonsense Mutation detected in F1 DNA During 2017
sa10449 Nonsense Available for shipment Available now
sa15700 Nonsense Available for shipment Available now
sa44980 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081801 Nonsense 229 572 6 15
ENSDART00000132942 Nonsense 229 571 6 15
Genomic Location (Zv9):
Chromosome 22 (position 4949203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTTCCTGCATTGAGTGTGTGTGTGTTTTCCTCCAGTGGCTGTCGTA[T/A]GGCGCGGACTCAAACGGCAGTGGCGTCGCTATACTGCTGGAGCTTGCGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081801 Nonsense 452 572 11 15
ENSDART00000132942 Nonsense 452 571 11 15
Genomic Location (Zv9):
Chromosome 22 (position 4945743)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4856989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATTGTGTCATCCAGGGCGTCACCGGAGACCTGGAGATCTTCACTGAA[C/T]AGATGGTGAGTATGAAGCACAAAANTACCATGTTCATAACATTTGGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081801 Nonsense 504 572 12 15
ENSDART00000132942 Nonsense 503 571 12 15
Genomic Location (Zv9):
Chromosome 22 (position 4944899)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4856145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCATCAGCTCAGCCGATACCTGAAGGACGTCAAGAGACACTTGGTG[C/T]GAGCAGACAAGAGGTCAGTCTGCACTCGCCGCTGCTGGAGTRGGCAAAWA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081801 Essential Splice Site 526 572 13 15
ENSDART00000132942 Essential Splice Site 525 571 13 15
Genomic Location (Zv9):
Chromosome 22 (position 4941775)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGAGTTTGTGTTTTATGATCAGCTCAAGCAGACCATGAATGCTTACAG[G/A]TGAGATCTGAAGCCATTTGAAGTTTAAATGTTAAGGATTACTTCTCTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link