ncl1

Ensembl ID:
ENSDARG00000058861
ZFIN ID:
ZDB-GENE-030131-8788
Description:
Nicalin-1 [Source:UniProtKB/Swiss-Prot;Acc:Q6NZ07]
Human Orthologue:
NCLN
Human Description:
nicalin [Source:HGNC Symbol;Acc:26923]
Mouse Orthologue:
Ncln
Mouse Description:
nicalin homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1926081]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10449 Nonsense Available for shipment Available now
sa15700 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10449
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081801 Nonsense 452 572 11 15
ENSDART00000132942 Nonsense 452 571 11 15
Genomic Location (Zv9):
Chromosome 22 (position 4945743)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4856989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCATTGTGTCATCCAGGGCGTCACCGGAGACCTGGAGATCTTCACTGAA[C/T]AGATGGTGAGTATGAAGCACAAAANTACCATGTTCATAACATTTGGTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081801 Nonsense 504 572 12 15
ENSDART00000132942 Nonsense 503 571 12 15
Genomic Location (Zv9):
Chromosome 22 (position 4944899)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 4856145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGCATCAGCTCAGCCGATACCTGAAGGACGTCAAGAGACACTTGGTG[C/T]GAGCAGACAAGAGGTCAGTCTGCACTCGCCGCTGCTGGAGTRGGCAAAWA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link