LOC566448

Ensembl ID:
ENSDARG00000058853
Human Orthologue:
SASH1
Human Description:
SAM and SH3 domain containing 1 [Source:HGNC Symbol;Acc:19182]
Mouse Orthologue:
Sash1
Mouse Description:
SAM and SH3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1917347]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15107 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081797 Essential Splice Site 383 1021 10 20
Genomic Location:
Chromosome 17 (position 6789292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCGATGGGGAGATGAGGAGAGCACTCAACCCAGCCAACTACCATGGAG[T/C]GAGTAMTAGTACCATTATTATTAACTTTAGTACTGTTTGYTTTATTTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a0cvyzzg