LOC795916

Ensembl ID:
ENSDARG00000058848
Human Orthologue:
MCOLN1
Human Description:
mucolipin 1 [Source:HGNC Symbol;Acc:13356]
Mouse Orthologue:
Mcoln1
Mouse Description:
mucolipin 1 Gene [Source:MGI Symbol;Acc:MGI:1890498]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38370 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33083 Nonsense Mutation detected in F1 DNA During 2016
sa19939 Nonsense Available for shipment Available now
sa39982 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081796 Essential Splice Site 200 565 4 13
Genomic Location (Zv9):
Chromosome 3 (position 6707936)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6132259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCGACCCAGTTAACGACACGTTCGACATAGACCCTCATGTTATTACTG[G/T]TGGGCAAAAAACAAATTAATGTTAATTTAATGTCACACAAACCAGTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33083
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081796 Nonsense 403 565 10 13
Genomic Location (Zv9):
Chromosome 3 (position 6695177)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6119500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGTATCCTGATGGGAACCTCCACTCTGCTGGTGTGGGTCGGGGTCATT[C/T]GATACTTCAGCTTCTTTCAGAAATATAACGTGAGTTCTGATTTTTTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081796 Nonsense 411 565 10 13
Genomic Location (Zv9):
Chromosome 3 (position 6695151)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6119474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGTGTGGGTCGGGGTCATTCGATACTTCAGCTTCTTTCAGAAATA[T/A]AACGTGAGTTCTGATTTTTTTTAAATGTTTATTTTGTGTGTATATATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081796 Nonsense 530 565 13 13
Genomic Location (Zv9):
Chromosome 3 (position 6681311)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6105634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGTTGTGTTTGTGTGTTTGTGTGCAGCAACAAACTCAAGACGTGCCG[C/T]AGGTTTCTGAACTGCACCGCTTCATCGCCGAGTGCACAGACACGCCCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link