si:ch73-212j7.3

Ensembl ID:
ENSDARG00000058835
ZFIN ID:
ZDB-GENE-081104-259
Description:
Novel protein similar to vertebrate pleckstrin homology domain containing, family G (With RhoGef dom
Human Orthologue:
PLEKHG3
Human Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 3 [Source:HGNC Symbol;Ac
Mouse Orthologue:
Plekhg3
Mouse Description:
pleckstrin homology domain containing, family G (with RhoGef domain) member 3 Gene [Source:MGI Symbo

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23626 Nonsense Available for shipment Available now
sa36947 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23626
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081781 Nonsense 43 973 1 23
ENSDART00000131697   None 527 None 2
ENSDART00000134137   None 188 None 6
Genomic Location (Zv9):
Chromosome 20 (position 3216889)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3170751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTACTTGGACCGTGTGGTTATGGAGATCATTGAGACCGAACGAATGTA[T/A]GTGAGAGATCTGCGGAGTATTGTTGAGGTAAGCATAAGCCTTTCAAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081781 Nonsense 935 973 23 23
ENSDART00000131697 Nonsense 362 527 1 2
ENSDART00000134137   None 188 None 6
Genomic Location (Zv9):
Chromosome 20 (position 3184581)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3138443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGCAGAAAGAAGGTAGACTCCTTAGCGCTCTAGCCCCCAGAGTCATC[C/T]AGTTAAGAGCAGAATCTGAATATGAGAGAGGCACAGGAGCTCAGTCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link