LOC558300

Ensembl ID:
ENSDARG00000058833
Human Orthologue:
TRIM42
Human Description:
tripartite motif-containing 42 [Source:HGNC Symbol;Acc:19014]
Mouse Orthologue:
Trim42
Mouse Description:
tripartite motif-containing 42 Gene [Source:MGI Symbol;Acc:MGI:1926161]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25989 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104903 Essential Splice Site 271 323 4 6
Genomic Location (Zv9):
Chromosome 3 (position 7016804)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6484324
KASP Assay ID:
2259-3018.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAGACACAGAGGAGATGCTGAACGCCAGTGATGACTGCTTACTGAAG[G/C]TCTGATTCTAGATGAGTGATTGATTGATTGATTGATTGATTGATTGAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link