sema5a

Ensembl ID:
ENSDARG00000058821
ZFIN ID:
ZDB-GENE-030131-8969
Description:
Semaphorin 5a [Source:UniProtKB/TrEMBL;Acc:B6E511]
Human Orthologue:
SEMA5A
Human Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh
Mouse Orthologue:
Sema5a
Mouse Description:
sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and sh

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37852 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32482 Essential Splice Site Available for shipment Available now
sa37853 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24468 Nonsense Available for shipment Available now
sa37854 Nonsense Mutation detected in F1 DNA During 2017
sa9240 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37852
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 152 1078 5 21
Genomic Location (Zv9):
Chromosome 24 (position 17112112)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16418588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTACCTGCGGAACAAATGCATTCACTCCTATTTGCACCAATCGCACGG[T/C]AAGTAAACGCATCAATGCACGTAATATAATGCAGAGGTTTCCTGGCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 224 1078 6 21
Genomic Location (Zv9):
Chromosome 24 (position 17116559)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16423035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCTTCCACCTCTGCGTACTGCTCAGTACAACTCCAAATGGCTCAATGG[T/G]AGGCTTAAAATATGAATGAAAGATTGAATTGAATTGAATTGAATTGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 699 1078 14 21
Genomic Location (Zv9):
Chromosome 24 (position 17180091)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16486567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGGCGAAGAACGTGTGAGAATGGAAATGAATGCCCTGGATGCAGCACT[G/T]TATGTAACAATAATATTAATACTAAGTTTATTTTTAAATGAGTATCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Nonsense 739 1078 15 21
Genomic Location (Zv9):
Chromosome 24 (position 17195799)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16502275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTGAATATCTCAGACAATGGTGGCCACTACGAGCAGCGCTTCAGATA[C/A]ACCTGTAAAGCTCGAGTCCCAGAGCCCGGCCTGCTGGAAGTTGGACGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37854
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Nonsense 855 1078 17 21
Genomic Location (Zv9):
Chromosome 24 (position 17234127)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16540603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTTTCCTTATCTTTCAGTGGACGGGAGCTGGTCGTGCTGGTCACCTT[G/A]GTCGAAATGCTCAGTGACATGCGGCGGAGGCCATTACATGCGCACACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081759 Essential Splice Site 902 1078 17 21
Genomic Location (Zv9):
Chromosome 24 (position 17234269)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 16540745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGTTTGYATACTGAAGAGGCCCTCTGCAACATCCAGCCCTGTCCTGG[T/A]ATGCACACACATTTGATTATTTTTAWCTGGAATGATGGTACTGATTAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Autism: A genome-wide linkage and association scan reveals novel loci for autism. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Parkinson's disease: High-resolution whole-genome association study of Parkinson disease. (View Study)
  • Uric acid levels: Genome-wide association of serum uric acid concentration: replication of sequence variants in an island population of the Adriatic coast of Croatia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link