bin1

Ensembl ID:
ENSDARG00000058820
ZFIN ID:
ZDB-GENE-030425-1
Description:
bridging integrator 1 [Source:RefSeq peptide;Acc:NP_001004602]
Human Orthologue:
BIN1
Human Description:
bridging integrator 1 [Source:HGNC Symbol;Acc:1052]
Mouse Orthologue:
Bin1
Mouse Description:
bridging integrator 1 Gene [Source:MGI Symbol;Acc:MGI:108092]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9213 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33802 Nonsense Mutation detected in F1 DNA During 2017
sa40630 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081761 Essential Splice Site 28 364 2 14
Genomic Location (Zv9):
Chromosome 6 (position 6945157)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6871173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTYGCGAATCATATGCAGAGCGTCATTTCTTTTGCTTTATTTTCCTGT[A/G]GGTGATGCAGAAACTGGGAAAGGCGGATGAAACCAAAGACACAGCCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33802
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081761 Nonsense 56 364 3 14
Genomic Location (Zv9):
Chromosome 6 (position 6944958)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6870974
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAATATCTAGTGATGGTTTCTTCTTTGACTCCTCTCTATTCACAGAAC[G/T]AGGGCACCAAACTGCAGAAAGACTTGAAAGCGTATTTGCTGGCAGTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081761 Nonsense 346 364 14 14
Genomic Location (Zv9):
Chromosome 6 (position 6916816)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6842832
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGCAGGATGATGGCTGGTTAATGGGTGTAAAAGAGTCCCACTGGCTT[C/T]AGAACAAAAACCTCCTAGCAAAAGGAGTCTTCCCTGAAAACTTCACCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link