rbm38

Ensembl ID:
ENSDARG00000058818
ZFIN ID:
ZDB-GENE-030131-5923
Description:
RNA-binding protein 38 [Source:RefSeq peptide;Acc:NP_001103597]
Human Orthologue:
RBM38
Human Description:
RNA binding motif protein 38 [Source:HGNC Symbol;Acc:15818]
Mouse Orthologue:
Rbm38
Mouse Description:
RNA binding motif protein 38 Gene [Source:MGI Symbol;Acc:MGI:1889294]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24252 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24252
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081763 Missense 223 234 4 4
ENSDART00000101474 Nonsense 222 245 5 5
ENSDART00000121480   None 211 None 4
Genomic Location (Zv9):
Chromosome 23 (position 6681534)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 6696749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAAACCCACTGTCCACCGGAGGAGGAGCCCCATCCACTGCCTTCATCC[A/T]GATCCCTCCACACCAGCTCCACACCGACCGCCTCTAGAACGGGAAACGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link