ihhb

Ensembl ID:
ENSDARG00000058815
ZFIN IDs:
ZDB-GENE-980526-135, ZDB-GENE-980526-135
Description:
Indian hedgehog B proteinIndian hedgehog B protein N-productIndian hedgehog B protein C-product [Sou
Human Orthologue:
IHH
Human Description:
Indian hedgehog [Source:HGNC Symbol;Acc:5956]
Mouse Orthologue:
Ihh
Mouse Description:
Indian hedgehog Gene [Source:MGI Symbol;Acc:MGI:96533]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20623 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20623
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081760 Nonsense 327 412 3 3
ENSDART00000122719 Nonsense 122 207 2 2
Genomic Location (Zv9):
Chromosome 6 (position 6977307)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 6903323
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCAGGAAGCGTTTTTCACAGATCACTCATGTTGGGGTTCGGGAGGAC[C/T]AGGGGTTATACGCTCCACTTACTGCTCATGGGACTGTAGTGGTGAACGAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Genome-wide association analysis identifies 20 loci that influence adult height. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link