rev3l

Ensembl ID:
ENSDARG00000058801
ZFIN ID:
ZDB-GENE-050302-55
Human Orthologues:
KIAA2022, REV3L
Human Descriptions:
KIAA2022 [Source:HGNC Symbol;Acc:29433]
REV3-like, catalytic subunit of DNA polymerase zeta (yeast) [Source:HGNC Symbol;Acc:9968]
Mouse Orthologues:
C77370, Rev3l
Mouse Descriptions:
expressed sequence C77370 Gene [Source:MGI Symbol;Acc:MGI:2148050]
REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like (S. cerevisiae) Gene [Source:MGI Symb

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25129 Nonsense Mutation detected in F1 DNA During 2016
sa19224 Nonsense Mutation detected in F1 DNA During 2016
sa11025 Nonsense Available for shipment Available now
sa32271 Nonsense Available for shipment Available now
sa36949 Nonsense Mutation detected in F1 DNA During 2016
sa43372 Nonsense Mutation detected in F1 DNA During 2016
sa32270 Essential Splice Site Available for shipment Available now
sa11290 Nonsense Available for shipment Available now
sa19223 Nonsense Mutation detected in F1 DNA During 2016
sa36948 Essential Splice Site Available for shipment Available now
sa43371 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa25129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 377 2953 10 32
ENSDART00000136987 Nonsense 47 2623 2 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3420262)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3363916
KASP Assay ID:
554-7709.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTCTTCTCATCATATAGATACAAAAAGGGACAGTAGAAAAGATGAC[G/T]AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235   None 95 None 3
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3420211)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3363865
KASP Assay ID:
2261-3903.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT[C/T]AGTCTTTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235   None 95 None 3
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3420211)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3363865
KASP Assay ID:
2261-3903.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT[C/T]AGTCTKTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32271
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 976 2953 13 32
ENSDART00000136987 Nonsense 646 2623 5 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3417768)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3361422
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTCAGTTCTGATGAAACTCACACAGTTTTAACACCGGAAAAGCTTGCT[G/T]GATATGAACAGCTTGCTCCTCTCAAAAAATTCTGGCCCAAAATTCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1208 2953 13 32
ENSDART00000136987 Nonsense 878 2623 5 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3417070)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3360724
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGAAAGGCCAATGTTTGTAGATGTCACATCTACTTCTCAGAAAGGATG[G/A]ATGCGCAATGAGAAGCAATTACTTCAAAGAAAGCAGGATCATGGCAAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1428 2953 13 32
ENSDART00000136987 Nonsense 1098 2623 5 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3416412)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3360066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTAAGAATAGGGAAATGTGTGTTTTGAAGGAACTTCTCCAGAAGAGG[C/T]AGCTTAAGGAAGAACAGGAAGCAAATAAAAGTGATGGTTTGACTGAGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32270
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Essential Splice Site 1757 2953 13 32
ENSDART00000136987 Essential Splice Site 1427 2623 5 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3415422)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3359076
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGGAACCATTCTACAGTGACCCGTCAGATGTGCCATTGAAGCCAAGG[T/C]AAGGTACACAAGTCTGTGTTGTAATTTTTTCTTGTTTAAAAGTTGCATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235   None 95 None 3
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3414992)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3358646
KASP Assay ID:
2261-3902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCCTAGCCGAGAGCAGGTGCAGCTTWGGGCGCAGGCCAAAAAACAGWA[T/A]GAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGWGATTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235   None 95 None 3
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3414992)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3358646
KASP Assay ID:
2261-3902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCTAGCCGAGAGCAGGTGCAGCTTTGGGCGCAGGCCAAAAAACAGTA[T/A]GAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGAGATTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Essential Splice Site 2216 2953 18 32
ENSDART00000136987 Essential Splice Site 1886 2623 10 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3408144)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3351798
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGTGATGAGAAGGAGCTGTTTGAAGAGGTCTCTAACATAATTAGGAA[G/A]TAGGTTTTTTATTTTCCTTTTTTAATTACGCTGCTTTGTTTCTGTCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 2237 2953 19 32
ENSDART00000136987 Nonsense 1907 2623 11 24
ENSDART00000148235   None 95 None 3
Genomic Location (Zv9):
Chromosome 20 (position 3407110)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3350764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTCTTGTTGGCTATGAGGTCCAGATGCATTCTTGGGGCTATTTACTA[C/T]AGCGTGCTTCAACGCTTGGTGTGAACTTGTGCCAACAACTATCCCGTGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link