rev3l

Ensembl ID:
ENSDARG00000058801
ZFIN ID:
ZDB-GENE-050302-55
Human Orthologues:
KIAA2022, REV3L
Human Descriptions:
KIAA2022 [Source:HGNC Symbol;Acc:29433]
REV3-like, catalytic subunit of DNA polymerase zeta (yeast) [Source:HGNC Symbol;Acc:9968]
Mouse Orthologues:
C77370, Rev3l
Mouse Descriptions:
expressed sequence C77370 Gene [Source:MGI Symbol;Acc:MGI:2148050]
REV3-like, catalytic subunit of DNA polymerase zeta RAD54 like (S. cerevisiae) Gene [Source:MGI Symb

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25129 Nonsense Mutation detected in F1 DNA During 2014
sa19224 Nonsense Mutation detected in F1 DNA During 2014
sa11025 Nonsense Available for shipment Available now
sa11290 Nonsense Available for shipment Available now
sa19223 Nonsense Mutation detected in F1 DNA During 2014
sa7927 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 377 2953 10 32
ENSDART00000136987 Nonsense 47 2623 2 24
ENSDART00000148235 None None 95 None 3
Genomic Location:
Chromosome 20 (position 3420262)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTCTTCTCATCATATAGATACAAAAAGGGACAGTAGAAAAGATGAC[G/T]AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235 None None 95 None 3
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235 None None 95 None 3
Genomic Location:
Chromosome 20 (position 3420211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT[C/T]AGTCTTTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11025
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235 None None 95 None 3
ENSDART00000092264 Nonsense 394 2953 10 32
ENSDART00000136987 Nonsense 64 2623 2 24
ENSDART00000148235 None None 95 None 3
Genomic Location:
Chromosome 20 (position 3420211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTAGCAGTTGTTGATGAAGAGGCCATTTTGAGCATGTTGGAAAATAGT[C/T]AGTCTKTCCTCCAGCTCTCTCAGACATCCAGCCAATCAGCAATATTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11290
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235 None None 95 None 3
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235 None None 95 None 3
Genomic Location:
Chromosome 20 (position 3414992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCCCTAGCCGAGAGCAGGTGCAGCTTWGGGCGCAGGCCAAAAAACAGWA[T/A]GAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGWGATTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19223
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235 None None 95 None 3
ENSDART00000092264 Nonsense 1850 2953 14 32
ENSDART00000136987 Nonsense 1520 2623 6 24
ENSDART00000148235 None None 95 None 3
Genomic Location:
Chromosome 20 (position 3414992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCCTAGCCGAGAGCAGGTGCAGCTTTGGGCGCAGGCCAAAAAACAGTA[T/A]GAGTGCCTTCAGAGAGGTAGGATACAAATGGGTGGCCATGAGATTTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092264 Essential Splice Site 2179 2953 18 32
ENSDART00000136987 Essential Splice Site 1849 2623 10 24
ENSDART00000148235 None None 95 None 3
Genomic Location:
Chromosome 20 (position 3408257)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAATATTAAATGTGTCTGTTTCAACATTATAGCTTGTTGTATTTTTTCNNNA[G/A]CTTCCAGAAGTTCGACACCYTTTCTTTTTAGGTGYGGTGTGACAGGACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dmhjcl6l