tmtopsa

Ensembl ID:
ENSDARG00000058787
ZFIN ID:
ZDB-GENE-030716-3
Description:
teleost multiple tissue opsin [Source:RefSeq peptide;Acc:NP_001112371]
Human Orthologue:
OPN3
Human Description:
opsin 3 [Source:HGNC Symbol;Acc:14007]
Mouse Orthologue:
Opn3
Mouse Description:
opsin 3 Gene [Source:MGI Symbol;Acc:MGI:1338022]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19657 Nonsense Mutation detected in F1 DNA During 2014
sa15922 Nonsense Available for shipment Available now
sa6005 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19657
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081729 Nonsense 32 387 1 4
Genomic Location:
Chromosome 2 (position 3340505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTGTGTCTCGGTGCAGTGGAGGGACATTTGGAGGCGTCCTCCTCCTA[T/A]CGCACCCTCAGTCCGACTGGACACATCCTCGTGGCGGTGAGCTTGGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081729 Nonsense 90 387 1 4
Genomic Location:
Chromosome 2 (position 3340331)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATCAACTTTCTGCTGGTGAAMATCTGCTTGAGCGATCTCCTGGTTTG[C/A]GTTCTGGGGACGCCGTTCAGCTTCGCGGCGAGCACGCAGGGGMGATGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081729 Nonsense 170 387 2 4
Genomic Location:
Chromosome 2 (position 3329787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGGTGATCGGTGGGGTGCTGAWGTCCTGGATCTACTCTTTAATTTG[G/A]ACCCTGCCTCCTCTGTTTGGSTGGAGCCGCTATGGCCCCGAAGGCCCCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/agpvdqh8