tfr1a

Ensembl ID:
ENSDARG00000058784
ZFIN ID:
ZDB-GENE-041220-1
Description:
transferrin receptor 1a [Source:RefSeq peptide;Acc:NP_001009917]
Human Orthologue:
TFRC
Human Description:
transferrin receptor (p90, CD71) [Source:HGNC Symbol;Acc:11763]
Mouse Orthologue:
Tfrc
Mouse Description:
transferrin receptor Gene [Source:MGI Symbol;Acc:MGI:98822]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1799 Missense F2 line generated During 2014

Mutation Details

Allele Name:
sa1799
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081717 Missense 147 770 3 17
ENSDART00000139602 Missense 147 468 3 10
Genomic Location:
Chromosome 2 (position 4754353)
KASP Assay ID:
554-1791.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGGCATTGCTCAAAAGGAAACTGACAACTGAAAACATTAACARCAAC[T/G]TCAAGTAATTGCACACACACACACACACGTTTGTTTTTGTGAATTGTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i7tc28xr