ENSDARG00000058782

Ensembl ID:
ENSDARG00000058782

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22993 Nonsense Available for shipment Available now
sa36307 Nonsense Mutation detected in F1 DNA During 2016
sa17887 Nonsense Available for shipment Available now
sa39142 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22994 Essential Splice Site Available for shipment Available now
sa42865 Nonsense Mutation detected in F1 DNA During 2016
sa36308 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36309 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36310 Nonsense Mutation detected in F1 DNA During 2016
sa39143 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa22993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Nonsense 142 1871 4 40
Genomic Location (Zv9):
Chromosome 17 (position 6618210)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6697146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTTTGTCTCCTGAAGGATTCCGATCTTCATAAAGTGACCGATGCTT[T/G]AAAGCAGCTCATTACATCAGTTTGCCAACCAGAAGCTTCATCCCTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Nonsense 151 1871 4 40
Genomic Location (Zv9):
Chromosome 17 (position 6618236)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6697172
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCATAAAGTGACCGATGCTTTAAAGCAGCTCATTACATCAGTTTGC[C/T]AACCAGAAGCTTCATCCCTTAAAGATACCTCTGATGTGTGGAGAAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Nonsense 168 1871 4 40
Genomic Location (Zv9):
Chromosome 17 (position 6618289)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6697225
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAAGCTTCATCCCTKAAAGATACCTCTGATGTGTGGAGAAACATTTA[T/G]AACACAGCAAACATGYTYCAGGTGAGTATCAGTAGAGAAATAGATGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39142
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Essential Splice Site 199 1871 5 40
Genomic Location (Zv9):
Chromosome 17 (position 6620429)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6699365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTACCCAAATATGCAGATCAGAGGCCCTCTGAGAGAAAGAGTGAAGGG[T/G]AATTTTAGGCCCAAAAAGGCTTTTCTTACTTAGAGTTTTTGTCTTGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Essential Splice Site 715 1871 15 40
Genomic Location (Zv9):
Chromosome 17 (position 6641707)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6720643
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGTTGGAAAATACATTCTTGTTGATTTTGGCTTCTTTCTTTTTTTCT[A/G]GGTTTATCCCAAACAGTCTTCCTCTTGCTGTTCAGGAACTTGATGAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Nonsense 923 1871 19 40
Genomic Location (Zv9):
Chromosome 17 (position 6648246)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6727182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATAATGGGCAAACCTGAAGACCCCCGAGCAGACCTGCAGGCCGAGGGC[A/T]GACCAAGTCCTGATCCCAGGTGAACATGTGGAGGGAAATTAGGTGATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Essential Splice Site 1273 1871 26 40
Genomic Location (Zv9):
Chromosome 17 (position 6665249)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6744185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACCATCAACACACCAGCGCTGTTTAAGCACTTCTCTCAGCTCTACAG[G/A]TCAATAACATTTATTCGTTCACTCTTAAAAACATTAGAGGTTTGTACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36309
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Essential Splice Site 1319 1871 27 40
Genomic Location (Zv9):
Chromosome 17 (position 6666732)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6745668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCTTCCACCTCCTGGAGCTGCAGAAGTCGACATCAAAGCATGGCAGG[T/C]AATAAAAATAAAAATAAAATCAGGATTATTACTGGTATGGAAAACTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Nonsense 1373 1871 29 40
Genomic Location (Zv9):
Chromosome 17 (position 6669834)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6748770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGATAAAGATCTGTGGAAAAGACCATCAGCGAAACACAGCGTATCTT[T/G]AGAGAGACCGCAGATTGTGGAGGATTTTATCCAGAGACTGATGAGCGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Nonsense 1429 1871 30 40
Genomic Location (Zv9):
Chromosome 17 (position 6670268)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6749204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTGTGCTGTAATGAATCGTGAGAAAAGCGTCTTCCAGCGGTATTCG[C/T]AGTTTTATGAGCACATCCTCCAACAGCAGGAGCAACTGCTTTACCAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link