ENSDARG00000058782

Ensembl ID:
ENSDARG00000058782

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22993 Nonsense Mutation detected in F1 DNA During 2014
sa17887 Nonsense Available for shipment Available now
sa22994 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22993
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Nonsense 142 1871 4 40
Genomic Location:
Chromosome 17 (position 6618210)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTTTGTCTCCTGAAGGATTCCGATCTTCATAAAGTGACCGATGCTT[T/G]AAAGCAGCTCATTACATCAGTTTGCCAACCAGAAGCTTCATCCCTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17887
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Nonsense 168 1871 4 40
Genomic Location:
Chromosome 17 (position 6618289)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGAAGCTTCATCCCTKAAAGATACCTCTGATGTGTGGAGAAACATTTA[T/G]AACACAGCAAACATGYTYCAGGTGAGTATCAGTAGAGAAATAGATGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22994
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081721 Essential Splice Site 715 1871 15 40
Genomic Location:
Chromosome 17 (position 6641707)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAGTTGGAAAATACATTCTTGTTGATTTTGGCTTCTTTCTTTTTTTCT[A/G]GGTTTATCCCAAACAGTCTTCCTCTTGCTGTTCAGGAACTTGATGAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qznrinpz